circad | circRNAs associated with diseases

hsa_circ_0024892
Gene	SNX19	Organism	Human
Genome Locus	chr2:152698416-152717334:-	Build	hg19
Disease	Multiple Sclerosis	ICD-10	Multiple sclerosis (G35)
DBLink	Link to database	PMID	28651352
Experimental Method
Sample Type	Blood samples	Comparison	45 patients with RR-MS, 10 CIS cases and 26 healthy donors
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GGGGTCTAGTCCTGGAGTCAC Reverse GCTCAGCCGGCATTTG	Statistics	Fold Change : Downregulated,4.44 pvalue : p=0.0427
Citation
Iparraguirre, L, Munoz-Culla, M, Prada-Luengo, I, Castillo-Trivino, T, Olascoaga, J, Otaegui, D (2017). Circular RNA profiling reveals that circular RNAs from ANXA2 can be used as new biomarkers for multiple sclerosis. Hum. Mol. Genet., 26, 18:3564-3572.